Color Space to fastq

As next generation sequencing is still evolving, so also myriad of tools that are built in and around these sequences . Applied Biosystems Dibase sequencing that uses ligation based chemistry ensures system accuracy and high throughputness.
 What is SOLiD system?
SOLiD stands for "Sequencing by Oligonucleotide Ligation and Detection". Due to its 2 base encoding system, it ensures greater accuracy e.g; 99.94% .
The decoding process is kind of tricky, since each color represents a dinucleotide. Altogether there are 4 colors i.e; 0,1,2,3 representing 4 bases A,C,G,T

Color Decoding

So, if a csfasta file has the first base known, then the subsequent bases can be calculated using the decoding table as below:

Example:
[0 -> AA, GG, CC, TT ; 1 -> CA, AC, TG, GT; 2-> GA, TC, AG, CT; 3 -> TA, GC, CG, AT]
>44_35_267_F3
T20220213203000111000122223221121222

T2 -> TC (number 2 can be GA,TC,AG,CT: but only TC starts with T, so the first number is deciphered to 'TC')
0  ->  CC
2  ->  CT
2  ->  TC
0  ->  CC
2  ->  CT
1  ->  TG
3  ->  GC
2  ->  CT
0  ->  TT and so on...

So, the colorspace translates into CCTCCTGCTT......

Now how about an error? If the colorspace is represented by a number >=4 or a "." , how to decode the rest of the reads? I guess, in that case, we can designate the rest of the reads as 'N', this can be done especially because we generate abysmally large number of reads and ignoring some of them will not matter much.

Converting Quality Scores:

Now, the next step is to convert the quality scores into sanger fastq format. Sanger Fastq standard was defined by Jim Mullikin, gradually disseminated, but never formally documented. The biggest drawback with the phred quality scores is that the need to separate numbers with space which increases storage space and numbers are often 2 digits numbers, which again adds up to the space issue.

Phred value is calculated as:

Qphred = -10 X log10(Pe), where P stands for probability score.

From Phred to Sanger:

Converting phred quality scores to Sanger Quality score is quite straight forward. Phred values 0 - 93 are represented by ASCII 33 - 126. 33 was used as a offset because ASCII 32 represents a white space.
The paper describing the details of sanger fastq and colorspace can be found here :


So, in order to convert Phred to Sanger in perl language;

$q = chr(($Q<=93? $Q : 93) + 33);
The paper describing Fastq format can be found here
Now how to code the colorspace to nucleotide conversion:
# Generate hash [popular notation]
my @code = ([0,1,2,3],[1,0,3,2],[2,3,0,1],[3,2,1,0]);
my @bases = qw(A C G T);
my %decode = ();
foreach my $i(0..3) {
      foreach my $j(0..3) {
          $decode{$code[$i]->[$j]} -> {$bases[$i]} = $bases[$j];
     }
}

Here $decode hash has values like:

$decode{0}->A = A;
$decode{1}->A = C;
$decode{2}->;A =G ;
$decode{3}->A =T ;
$decode{1}->C =A ;
$decode{0}->C =C ;
$decode{3}->C =G ;
$decode{2}->C =T ;
$decode{2}->G = A;
$decode{3}->G =C ;
$decode{0}->G =G ;
$decode{1}->G =T ;
$decode{3}->T =A ;
$decode{2}->T =C ;
$decode{0}->T =G ;
$decode{1}->T =T ;
sub decode{
my $str=shift;
my @arr = split($str,'');
my $seq='';
my $base='';
my $anchor = shift(@arr); # The first anchor tag
    for(my $i=0;$i<@arr;$i++){
        $base=$decode{$arr[$i]}->{$anchor};
        $seq .= $base;
        $anchor = $base;
    }
return $seq;

} # End of subroutine
[Modified version of the script can be found here]

Plotting SAM output

Output from Nextgeneration sequence alignment to genome assembly comes in SAM(Sequence Alignment Map) format. SAM files can be large, so a binary format called BAM is used most often for ease of handling. While full documentation on samtools can be found here , documentation on SAM format can be found here. For quick reference, let me put the SAM alignment format here:


[qname][flag][rname][pos][mapq][cigar][mrnm][mpos][isize][seq][qual][tag][vtype]
[qname]: Query Name
[flag]:      Is a bitwise operator represented in  decimal format, where the value when converted into binary should have the following meaning:
0x0001 the read is paired in sequencing, no matter whether it is mapped in a pair
0x0002 the read is mapped in a proper pair (depends on the protocol, normally inferred during alignment) 1
0x0004 the query sequence itself is unmapped
0x0008 the mate is unmapped 1
0x0010 strand of the query (0 for forward; 1 for reverse strand)
0x0020 strand of the mate 1
0x0040 the read is the first read in a pair 1,2
0x0080 the read is the second read in a pair 1,2
0x0100 the alignment is not primary (a read having split hits may have multiple primary alignment records)
0x0200 the read fails platform/vendor quality checks
0x0400 the read is either a PCR duplicate or an optical duplicate
Where;
1. Flag 0x02, 0x08, 0x20, 0x40 and 0x80 are only meaningful when flag 0x01 is present.
2. If in a read pair the information on which read is the first in the pair is lost in the upstream analysis, flag 0x01 should be present and 0x40 and 0x80 are both zero.
Example: In our case, we mostly get 0 or 16 as the value, where 0 means(00000000000) forward strand and 16 means(00000010000) reverse strand. We are NOT concerned about rest of the bits because ours is not a paired end alignment.
CIGAR FORMAT:
M Alignment match (can be a sequence match or mismatch)
I Insertion to the reference
D Deletion from the reference
N Skipped region from the reference
S Soft clip on the read (clipped sequence present in )
H Hard clip on the read (clipped sequence NOT present in )
P Padding (silent deletion from the padded reference sequence)
Lets not discuss about the other fields
Samtools view command:
samtools view  $DATAFILE/sorted.bam super_0:1000-30000 | cut -f 2,3,4,10 > tmp2
[One thing to remember here is the sorted bam files need to be indexed before using this command. So, in other words keep the index files(sorted.bam.bai ) in the same directory.
super_0 25699   ATTTAAACTAAGCTACGCTTCCTCACATACACGCGTACACGTGTAAGC 
OR
If you want to see it in human readable format use '-X' after 'samtools view'
The output could be:
        super_0 35110   CGGTTGCTAGCGTTAGTGCTGAGGAAACCCTTTAGATCGTAATCCAGT
r       super_0 41561   TGTCGTGTGTACTGAGAAACTTGTATGATGTCTGAATTCTTCAGGCTG


Where the first line means the forward strand and the second line means the reverse strand

Pneumococcal Fratricides

 Excerpts from César Sánchez's blog
Some bacteria produce substances that kill surrounding microbes, and use the resulting dead bodies as a source of nutrients. Sometimes, killer and victim belong to the same species, or even they are siblings. In these cases, researchers speak of cannibalism or fratricide; although if you view microbial populations as coordinated, multicellular entities, then you may prefer to use the term programmed cell death.
Among pneumococci, some cells in a population become competent in response to certain signals; which means that they are able to take up DNA from their surroundings, and incorporate this genetic information into their own chromosome. This way, competent cells can acquire new inheritable abilities—such as production of a new capsule type, or resistance to an antibiotic—that can be very important for their survival. (This was the underlying mechanism in the famous Avery-MacLeod-McCarty experiment that helped identify DNA as the hereditary material in cells.)
But competent pneumococci do something else: they encourage non-competent siblings and other closely-related bacteria to commit suicide. They do this by releasing a particular lytic enzyme, called CbpD, that diffuses through the milieu and—somehow—activates LytC and other lytic enzymes that are already present in the non-competent siblings. Cell wall weakening finally results in a big bang: that is, the explosion of the non-competent pneumococci. The materials released serve not only as nutrients and sources of genetic information (DNA), but also as virulence factors that help competent cells to survive in their human host.

The structure of the pneumococcal
autolysin, LytC. Source.

The 3D structure of LytC now provides the clues to explain the enzyme's peculiar behaviour during pneumococcal fratricide. Have a look at the model of LytC on the right: ain't it a beauty? A substrate-binding module (in blue and green in the image) recognizes and binds the cell wall peptidoglycan, whereas a catalytic module (in red) is responsible for breaking a specific linkage in the substrate. Because of the unusual hook shape of the protein, the substrate-binding module and the catalytic module partially block each other. As a result, LytC cannot bind the highly cross-linked peptidoglycan that is predominant under normal circumstances. Only when CbpD or other lytic enzymes cut specific linkages in the cell wall, LytC is able to bind the 'loosened' peptidoglycan and comes into action—with deleterious consequences for the non-competent pneumococci.

How To Embed Slideshare Into regular web pages

In the following presentation, it is described how to embed slide share on your wiki space, but if you want to  embed this on any regular web page, just use the same "embed html" code and copy paste in a html page. One thing to remember is,  first make your slide share upload public. If you make it private, then you will get "embed slide share" functionality disabled.

How To Embed Slideshare Into Wikispaces

View more presentations from diannekrause.

Protein cereblon, Homo sapiens (Human) : Q96SW2

This months protein Cereblon at protein Spotlight.

Link

JCVI Team Creates Functional Microbe Controlled By Synthetic Genome

May 20, 2010

By a GenomeWeb staff reporter

NEW YORK (GenomeWeb News) – A team of J. Craig Venter Institute researchers reported online today in Science that they have successfully created the first functional bacterial cells controlled by a synthetic genome.
The researchers amalgamated several of their previously reported approaches for the study, which involved creating a synthetic Mycoplasma mycoides genome called JCVI-syn1.0 and transplanting it into a M. capricolum strain. In so doing, the team was able to produce functional, self-replicating cells that closely resemble natural M. mycoides cells.
"This work provides a proof of principle for producing cells based on genome sequences designed in the computer," senior author Craig Venter and his colleagues wrote. "[T]he approach we have developed should be applicable to the synthesis and transplantation of more novel genomes as genome design progresses."
"This is the first self-replicating species we've had on the planet whose parent is a computer," Venter said today during a telephone briefing with reporters.
In early 2008, researchers from the Venter Institute reported on the first synthetic genome, creating four M. genitalium quarter-genomes that were assembled in yeast. The team subsequently streamlined this process so that dozens of pieces of the M. genitalium genome could be assembled in yeast in a single step.
Because M. genitalium grows very slowly, the researchers explained, they decided to design a new synthetic genome based on the sequence of another species — the M. mycoides subspecies capri — for their current synthetic transplant work.
JCVI researchers previously showed that they could transfer a natural M. mycoides genome into M. capricolum — most recently using yeast as a stop en route in this transplant process.
For the current study, funded by Synthetic Genomics, the team designed cassettes for building a synthetic M. mycoides subspecies capri GM12 genome based on finished genome sequences for two M. mycoides strains — one used as a genome donor in a previous genome transfer study and another containing a transplanted genome that was cloned in yeast.
The latter strain was primarily used as the design reference, the researchers noted, with the synthetic genome matching that genome at all but 19 harmless polymorphisms.
Similar to synthetic genomes designed at JCVI in the past, the team tossed watermark sequences into the synthetic genome, placing them at sites that weren't expected to affect cell growth or viability. Such watermarks are intended "to absolutely make clear that the DNA was synthetic," Venter said.
The watermark sequences used in the new M. mycoides synthetic genome were designed using a code containing frequent stop codons that represents all of the letters in the English alphabet as well as punctuation, Venter explained. These watermarks not only contain the names of nearly four dozen study authors and project contributors, but also a web address and three quotations, he added, including quotes from James Joyce and Richard Feynman.
The Washington-based company Blue Heron synthesized the cassettes, each about 1,080 base pairs long, and these cassettes were then assembled via a series of steps in yeast and Escherichia coli, using multiplex PCR and restriction enzyme analyses to find and verify complete synthetic genomes.
Next, the team transplanted complete synthetic genomes into M. capricolum subspecies capricolum cells lacking restriction enzymes that would chop up the transferred genome, which had been unmethylated during its detour in yeast.
Once they had found cells harboring the synthetic genome, the researchers tested the functionality, characteristics, and growth patterns of the recipient cell, comparing those transplanted with either fully synthetic or semi-synthetic genomes.
Indeed, they found that cells transplanted with the complete synthetic M. mycoides genome are capable of self-replication, have phenotypic and growth patterns resembling natural M. mycoides cells, and produce a set of proteins that appears to be nearly identical to those found in M. mycoides, though their growth rate was slightly higher than natural control cells in at least one set of experiments.
Even so, the researchers cautioned, synthetic genome transplantation is far from simple and relies on precise genetic information.
"[O]btaining an error-free genome that could be transplanted into a recipient cell to create a new cell controlled only by the synthetic genome was complicated and required many quality control steps," the team noted, pointing to a problem they encountered when they inadvertently attempted to transplant a synthetic genome carrying a lone deletion in an essential gene.
"One wrong base out of over one million in an essential gene rendered the genome inactive, while major genome insertions and deletions in non-essential parts of the genome had no observable impact on viability," they wrote.
Overall though, those involved in the study are optimistic that their approach holds potential for creating synthetic cells with a range of applications — including bugs that can be used for everything from biofuel production and environmental cleanup to vaccine production.
"If the methods described here can be generalized, design, synthesis, assembly, and transplantation of synthetic chromosomes will no longer be a barrier to the progress of synthetic biology," the researchers concluded. "We expect that the cost of DNA synthesis will follow what has happened with DNA sequencing and continue to exponentially decrease. Lower synthesis costs combined with automation will enable broad applications for synthetic genomics."
For instance, Venter noted that the team plans to tackle the problem of making synthetic algae cells in the near future.
"I have no doubt that [co-author Daniel Gibson] and the team can easily make a synthetic algae chromosome," he said. "I think the biology will be challenging because we have to find an appropriate recipient cell to boot up that chromosome. Both have to happen in parallel."
Venter said Synthetic Genomics has filed multiple patents related to the methods used in various stages of the synthetic cell research on behalf of JCVI.

Cloud Computing Tutorial - Jens Nimis

Check out this SlideShare Presentation:

Cloud Computing Tutorial - Jens Nimis

View more presentations from JensNimis.

The rap guide to Evolution

-By Baba Brinkman

Brinkman, a Canadian from Vancouver, a self-styled “rap troubadour,” with a master’s degree in English and a history of tree-planting (he has personally planted more than one million trees - according to his web site).

This is the only hip hop show that talks about mitochondria, genetic drift, sexual selection or memes. For Brinkman has taken Darwin’s exhortation seriously. He is a man on a mission to spread the word about evolution — how it works, what it means for our view of the world, and why it is something to be celebrated rather than feared.

At the end of the show he talks about the social slime mold Dictyostelium discoidium streaming together while rapping about how cooperation evolves.
Dictyostelium is notorious, in some circles, for its strange life-style. Usually, an individual Dictyostelium lives alone as a single cell. But when food is scarce, the single cells come together and form a being known as “the slug”; this crawls off in search of better conditions. When it finds them, the slug develops into a stalked fruiting body, and releases spores. But here’s the mystery: not all members of the slug get to make spores — and thereby contribute to the next generation — so why do they cooperate?
Here it is:

Simple pubmed API

if ($xml = simplexml_load_file('http://eutils.ncbi.nlm.nih.gov/entrez/eutils/esearch.fcgi?db=pubmed&retmax=0&usehistory=y&term=' . urlencode($argv[1]))){
if ($xml = simplexml_load_file("http://eutils.ncbi.nlm.nih.gov/entrez/eutils/esummary.fcgi?db=pubmed&retmode=xml&query_key={$xml->QueryKey}&WebEnv={$xml->WebEnv}&retstart=0&retmax=10")){
$docs = $xml->DocSum;
}
}
print_r($docs);
More can be found here

Anne Wojcicki talks at TedMed - an interesting video

Packaging your source code

I have written down few software packages but never released any of them officially into the nicer ./configure && make && make install format.

We have created a C package that does what GCRMA would do plus much more in a very memory efficient way. Although GCRMA C source is available for free consumption, it needed quite some work on our end to customize it. Now that it is already written down, I am settling for releasing it under GNU open source license.

Few things need to be taken care of before creating the package:

1. Put all your C sources under src/ directory
2. All data such as sample CEL files need to go to /data directory
3. Accessory scripts like split file, merge file, plotting with R need to go to script/ directory
4. Documents go to /doc directory

RUN CONFIGURATION UTILITY:

First run autoscan

With all likelihood this command will exit with error. Nevertheless, it produces a configure.scan file.
Open configure.scan file and edit the line with
AC_INIT(PACKAGE NAME, VERSION, CONTACT EMAIL)
into useful inputs like
AC_INIT(Modified GCRMA, 1.0, tsucheta@gmail.com)

$ mv configure.scan configure.ac(Note configure.in used to be the earlier version)

$autoconf

This will create the configure file.

Makefile.am

You need to create a series of makefile.am files each inside your /script /man/ doc/ bin/ directories with appropriate values.

In your src/ directory you may like to keep useful information like:

# what flags you want to pass to the C compiler & linker
AM_CFLAGS = --pedantic -Wall -std=c99 -O2
AM_LDFLAGS =

# this lists the binaries to produce, the (non-PHONY, binary) targets in
# the previous manual Makefile


#bin_SCRIPTS = scripts/split.pl scripts/merge.pl scripts/plot.R
bin_PROGRAMS = Modified GCRMA
loglikelihood_SOURCES = file1.c file2.c file3.c file4.c file5.c...

GCRMA_LDADD = -lm -lz
main.o: main.c utility.h
cc -c main.c
calculate.o: calculate.c utility.h
cc -c calculate.c
read_seq.o: read_seq.c utility.h
cc -c read_seq.c
read_file.o: read_file.c utility.h
cc -c read_file.c
rev_complement.o: rev_complement.c utility.h
cc -c rev_complement.c
detect_chimera.o: detect_chimera.c utility.h
cc -c detect_chimera.c
find_orf.o: find_orf.c utility.h
cc -c find_orf.c
command.o: command.c utility.h
cc -c command.c
process.o: process.c utility.h
cc -c process.c
clean:
rm -f *.o

in scripts directory change makefile.am into
bin_SCRIPTS = file1.pl file2.pl file3.R file4.sh....

in Man directory change
man_MANS = man.1 man.2 man.3...

Now go back to configure.ac file and make changes to the line just after

AC_INIT()
into
AM_INIT_AUTOMAKE(ModifiedGCRMA, 1.0). This will initialize automake

And at the bottom of the configure.ac file make the following changes

AC_OUTPUT(Makefile src/Makefile doc/Makefile man/Makefile scripts/Makefile)

Now run aclocal followed by automake --add-missing

automake will read makefile.am and create a makefile.in file for configure to create a final make file.

While reading automake be cautioned - you may be asked for files
NEWS,README,AUTHORS,ChangeLog

Never mind you can create those files using
touch NEWS
touch README
touch AUTHORS
touch ChangeLog

If automake did not generate makefile.in the previous time, run it again.

you may like to build the configure script again using autoconf.

Once this is done, you are all set. You may run ./configure --prefix-path="YOUR_PATH"

followed by make make install

You may pack your stuff using command make dist.

Here few of the autoconf macros are listed.

A reasonable list of free and paid softwares for nextgen sequence analysis

http://www.oxfordjournals.org/our_journals/bioinformatics/nextgenerationsequencing.htmlA great list on free and paid softwares for nextgen sequence analysis is available at the seqanswers forum here.

To browse through a compiled list of Bioinformatics Softwares click here.

A list of publications devoted at the Bioinformatics journal here
Now I am working on samtools and bowtie and will write a detailed review soon...

AGBT 2010

AGBT(Advances in Genome Biology and Technology) was recently concluded at Florida(24-27th Feb 2010). Anthony Fejas has done a great job in putting the outlines of the presentations in his blog . Check out for details.

Aragonite - what it is?

Aragonites are Calcium carbonate crystals found in pearl.
In December 2009 issue of ProteinSpotlight, a very interesting protein is featured. This protein complex is none other than the one that gives luster to pearl. The complex is made out of three proteins, known as the Pif complex in which is found pearlin, Pif80 and Pif97. Pif80 and 97 are part of the same sequence which is subsequently cleaved into two.Pif80 – by way of its many asparagine residues – binds to calcium carbonate and not only elicits aragonite crystal formation but also has a role in the orientation of the aragonite crystals. Here is the Full link to the article..

Top five Biology papers for 2009

ScienceWatch tracks and analyzes trends in basic science research, compiles bimonthly lists of the 10 most cited papers. From that list The scientist pulled 5 papers published within the last two which were the most cited in 2009. The two topics that dominate the top five papers this year: genomics and stem cells.

Following is the list:

1. K. Takahashi, et al., "Induction of pluripotent stem cells from adult human fibroblasts by defined factors," Cell, 131: 861-72, 2007.
Citations this year: 520
Total citations to date: 886
Findings: This work from Shinya Yamanaka's lab in Japan was the first to demonstrate that induced pluripotent stem (iPS) cells can be generated from adult human dermal fibroblasts. Previous efforts by the team showed that iPS cells could be derived from mouse somatic cells. This paper was an easy top pick, receiving the most citations this year, according to ScienceWatch.

2. K.A. Frazer, et al., "A second generation human haplotype map of over 3.1 million SNPs," Nature, 449: 854-61, 2007.
Citations this year: 389
Total citations to date: 588
Findings: Since the sequencing of the human genome in 2003, the International HapMap Project has explored single nucleotide polymorphisms (SNPs) -- differences in a single letter of the DNA -- to study how these small variations affect the development of diseases and the body's response to pathogens and drugs. HapMap I, the original report, placed one SNP at roughly every 5,000 DNA letters. The newest map, featured in this paper, sequenced an additional 2 million SNPs, increasing the map's resolution to one SNP per kilobase. The additional detail allows scientists to more closely investigate patterns in SNP differences, especially in hotspot regions, or concentrated stretches of DNA.

3. A. Barski, et al., "High-resolution profiling of histone methylations in the human genome," Cell, 129: 823-37, 2007.
Citations this year: 299
Total citations to date:: 560
Findings: This study looked at how histone modifications influence gene expression in more detail than previous attempts. Using a powerful sequencing tool called Solexa 1G, the researchers mapped more than 20 million DNA sequences associated with specific forms of histones, finding there were differences in methylation patterns between stem cells and differentiated T cells.

4. E. Birney, et al., "Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project, "Nature, 447: 799-816, 2007.
Citations this year: 267
Total citations to date: 618
Findings: The ENCODE project -- ENCODE stands for the ENCyclopedia Of DNA Elements -- set out to identify all functional elements in the human genome. After examining one percent of the genome, the paper revealed several new insights about how information encoded in the DNA comes to life in a cell.

5. A M. Wernig, et al., "In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state," Nature 448: 318-24, 2007.
Citations this year: 237
Total citations to date: 512
Findings: Scientists successfully performed somatic-cell nuclear transfer (SCNT), producing stem cell lines and cloned animals for the first time using fertilized mouse eggs. This paper consistently ranked in the top 10 most cited papers in 2009, according to ScienceWatch.

Death of End Note

I guess now End Note software will die a natural death!! I am not saying this just because I am not particularly fond of this software, but lately it has fierce competitions from various resources including my NCBI. Before My NCBI came into picture, I was very fond of connotea. Connotea is very easy to link to a browser, all that you will need is to drag and drop it to the menu bar. You can create your own login and password and update all the bibliography you ever wanted. Export the bibliography as you wish.

With My NCBI, it has struck the nail right on the head of End Note. Tutorials are readily available for My NCBI for easy use. Anytime, I would prefer a browser based application than a stand alone application. End note particularly needed endless filling up forms very tedious ways. I had bad experience of interference of end note with MS office 2007. Now I will breath easy writing a manuscript.

This years Nobel Prize in Medicine

This years Nobel prize in Medicine goes jointly to Elizabeth Blackburn, Carol Greider, and Jack Szostak for their work on telomeres. In the 1970s, Blackburn identified repeating segments at the ends of DNA in Tetrahymena while Szostak found that single-stranded DNA was rapidly degraded in yeast. Blackburn and Szostak then collaborated on a project, finding that the Tetrahymena DNA protected the single-stranded DNA from degradation in yeast. In 1984, Blackburn and Greider, her graduate student, discovered telomerase. The Nobel citation lauds these researchers for their contribution to the study of aging, cancer, and other diseases. "The discoveries by Blackburn, Greider and Szostak have added a new dimension to our understanding of the cell, shed light on disease mechanisms, and stimulated the development of potential new therapies," it says.

The mysterious telomere

The chromosomes contain our genome in their DNA molecules. As early as the 1930s, Hermann Muller (Nobel Prize 1946) and Barbara McClintock (Nobel Prize 1983) had observed that the structures at the ends of the chromosomes, the so-called telomeres, seemed to prevent the chromosomes from attaching to each other. They suspected that the telomeres could have a protective role, but how they operate remained an enigma.

When scientists began to understand how genes are copied, in the 1950s, another problem presented itself. When a cell is about to divide, the DNA molecules, which contain the four bases that form the genetic code, are copied, base by base, by DNA polymerase enzymes. However, for one of the two DNA strands, a problem exists in that the very end of the strand cannot be copied. Therefore, the chromosomes should be shortened every time a cell divides – but in fact that is not usually the case (Fig 1).

Both these problems were solved when this year's Nobel Laureates discovered how the telomere functions and found the enzyme that copies it.


Telomere DNA protects the chromosomes

In the early phase of her research career, Elizabeth Blackburn mapped DNA sequences. When studying the chromosomes of Tetrahymena, a unicellular ciliate organism, she identified a DNA sequence that was repeated several times at the ends of the chromosomes. The function of this sequence, CCCCAA, was unclear. At the same time, Jack Szostak had made the observation that a linear DNA molecule, a type of minichromosome, is rapidly degraded when introduced into yeast cells.

Blackburn presented her results at a conference in 1980. They caught Jack Szostak's interest and he and Blackburn decided to perform an experiment that would cross the boundaries between very distant species (Fig 2). From the DNA of Tetrahymena, Blackburn isolated the CCCCAA sequence. Szostak coupled it to the minichromosomes and put them back into yeast cells. The results, which were published in 1982, were striking – the telomere DNA sequence protected the minichromosomes from degradation. As telomere DNA from one organism, Tetrahymena, protected chromosomes in an entirely different one, yeast, this demonstrated the existence of a previously unrecognized fundamental mechanism. Later on, it became evident that telomere DNA with its characteristic sequence is present in most plants and animals, from amoeba to man.


An enzyme that builds telomeres

Carol Greider, then a graduate student, and her supervisor Blackburn started to investigate if the formation of telomere DNA could be due to an unknown enzyme. On Christmas Day, 1984, Greider discovered signs of enzymatic activity in a cell extract. Greider and Blackburn named the enzyme telomerase, purified it, and showed that it consists of RNA as well as protein (Fig 3). The RNA component turned out to contain the CCCCAA sequence. It serves as the template when the telomere is built, while the protein component is required for the construction work, i.e. the enzymatic activity. Telomerase extends telomere DNA, providing a platform that enables DNA polymerases to copy the entire length of the chromosome without missing the very end portion.

Blackburn was also the Daily Scan poll favorite. She led the pack with 43 percent of the vote. She was followed by her co-laureate Szostak who garnered 25 percent of the vote.

References:
Szostak JW, Blackburn EH. Cloning yeast telomeres on linear plasmid vectors. Cell 1982; 29:245-255.
Greider CW, Blackburn EH. Identification of a specific telomere terminal transferase activity in Tetrahymena extracts. Cell 1985; 43:405-13.
Greider CW, Blackburn EH. A telomeric sequence in the RNA of Tetrahymena telomerase required for telomere repeat synthesis. Nature 1989; 337:331-7.

Oldest Human ancestor discovered

How old are humans? Until recently I thought Lucy to be our oldest ancestor, that is around 3.9 to 2.9 million years old. A recent finding by a group of scientists reveals our oldest known ancestor "Lucy" is now replaced by "Ardi"(Ardipithecus ramidus) which is older by 1.4 million years than Lucy.This individual, 'Ardi,' was a female who weighed about 50 kilograms and stood about 120 centimetres tall.

In its 2 October 2009 issue, Science presents 11 papers, authored by a diverse international team, describing an early hominid species, Ardipithecus ramidus, and its environment. These 4.4 million year old hominid fossils sit within a critical early part of human evolution, and cast new and sometimes surprising light on the evolution of human limbs and locomotion, the habitats occupied by early hominids, and the nature of our last common ancestor with chimps.

Science is making access to this extraordinary set of materials FREE (non-subscribers require a simple registration). The complete collection, and abridged versions, are available FREE as PDF downloads for AAAS members, or may be purchased as reprints.

The last common ancestor shared by humans and chimpanzees is thought to have lived six or more million years ago. Though Ardipithecus is not itself this last common ancestor, it likely shared many of this ancestor's characteristics. Ardi is closer to humans than chimps. Measuring in at 47 in. (120 cm) tall and 110 lb. (50 kg), Ardi likely walked with a strange gait, lurching side to side, due to lack of an arch in its feet, a feature of later hominids. It had somewhat monkey-like feet, with opposable toes, but its feet were not flexible enough to grab onto vines or tree trunks like many monkeys -- rather they were good enough to provide extra support during quick walks along tree branches -- called palm walking.

Another surprise comes in Ardi's environment. Ardi lived in a lush grassy African woodland, with creatures such as colobus monkeys, baboons, elephants, spiral-horned antelopes, hyenas, shrews, hares, porcupines, bats, peacocks, doves, lovebirds, swifts and owls. Fig trees grew around much of the area, and it is speculated that much of Ardi's diet consisted of these figs.

The surprise about the environment is that it lays to rest the theory that hominids developed upright walking when Africa's woodland-grassland mix changed to grassy savanna. Under this now theory, hominids began standing and walking upright as a way of seeing predators over the tall grasses. The discovery of Ardi -- an earlier upright walker that lived in woodland -- greatly weakens this theory.

Scientists have theorized that Ardi may have formed human-like relationships with pairing between single males and females. Evidence of this is found in the male's teeth, which lack the long canines that gorillas and other non-monogamous apes use to battle for females. Describes Professor Lovejoy, "The male canine tooth is no longer projecting or sharp. It's no longer weaponry."

Restoring your dell laptop to factory setup

I have a dell laptop that had become extremely slow. I was looking at the options of cleaning the resgistry, cleaning up temporary internet files and all other available suggestions on internet. However, this did not help much. My laptop became almost unusable!! My desperate searches in the internet led me to find something like "While booting your system hold your control and f10 key" or "While booting your system hold your control and f11 key" or "While booting your system hold your control and f12 key" to get to setup option. I tried with F10, but it did not work, so I left the rest of the options.

The best way to look for the right combination of keys is to get hold of your DELL manual that comes along with your installation. It is sometimes also called "Owners manual". Once you got hold of it look for the "solving problem" -> "Restoring your operating system" section. Inside this section, you will find specific instructions as to how to get back to your factory default mode. For example mine says the following:

To use PC Restore:
1 Turn on the computer.
During the boot process, a blue bar with www.dell.com appears at the top of the screen.
2 Immediately upon seeing the blue bar, press < Ctrl >< F11 >.
If you do not press < Ctrl >< F11 > in time, let the computer finish starting, and then restart
the computer again.
NOTICE: If you do not want to proceed with PC Restore, click Reboot in the following step.
3 On the next screen that appears, click Restore.
4 On the next screen, click Confirm.
The restore process takes approximately 6–10 minutes to complete.
5 When prompted, click Finish to reboot the computer.
NOTE: Do not manually shut down the computer. Click Finish and let the computer completely
reboot.
6 When prompted, click Yes.
The computer restarts. Because the computer is restored to its original operating state, the
screens that appear, such as the End User License Agreement, are the same ones that
appeared the first time the computer was turned on.
7 Click Next.
The System Restore screen appears and the computer restarts.
8 After the computer restarts, click OK.

And needless to mention this worked like charm!! I got the desirable result. My computer works like new!! Only trouble is, you would have lost all your data and any new installations. But I don't think this is a big price to pay for this great change in performance. Installing softwares as you need and backing up data is something does not take a lot of effort.. So happy restoring your system.

ncftp and wget

As a bioinformatics researcher, it often becomes imperative to download a large amount of data sets from various servers. The most frequent data download site is NCBI and/or EBI. While most of the raw data can be found at NCBI, EBI hosts something much more curated. One nightmare I often face is, updating interproscan database. The data files are something like 9GB and take a lot of time to download, often exceeding the data limit for our server that downloads it. The most irritating of all is when it times out or says "the message list is too long". The best way to handle this trouble could be by using "wget" or "ncftp".

It is very simple to use and is very user friendly. Wget is very reliable and robust. It is specially designed for the home network if you are working from home using an unreliable network. If a download does not complete due to a network problem, Wget will automatically try to continue the download from where it left off, and repeat this until the whole file has been retrieved. It was one of the first clients to make use of the then-new Range HTTP header to support this feature.

If you are using the http protocol with wget then the format will be something like this:
wget --no-check-certificate https://login:passwd@site-address//path
or
wget ftp://ftp.gnu.org/pub/gnu/wget/wget-latest.tar.gz
Or more command info can be found by doing "man wget".

While wget is really cool, ncftp is another ftp protocol, that is sometimes much better than other existing methods, if you must use a ftp protocol for data download. A typical ncftp command could be:

ncftp -u login -p pass ftp://ftp.hostname.edu

Then use get command to get the files of interest.